shrna lentiviral vectors Search Results


90
PSICOR Inc lentiviral vectors--shrnas
Lentiviral Vectors Shrnas, supplied by PSICOR Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+lentiviral+vectors/10__1074_slash_jbc__m115__641837-76-0-19?v=PSICOR+Inc
Average 90 stars, based on 1 article reviews
lentiviral vectors--shrnas - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma si-stc1
Si Stc1, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+lentiviral+vectors/pmc11699165-68-8-16?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
si-stc1 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH shrna lentiviral vectors targeting mouse flcn
(A and B) Detection of phagocytic activity of RAW 264.7 cells expressing a <t>control</t> <t>shRNA</t> or an shRNA targeting <t>Flcn</t> against pHrodo-SE-labeled untreated or heat-treated (for 3 min at 60°C) bone marrow cells (BMC) by flow cytometry. Representative fluorescence-activated cell sorting (FACS) plots are shown (A). Mean fluorescence intensities (MFIs) of pHrodo red in ZsGreen1-positive RAW cells were analyzed and are graphically represented (B) (n = 4; *p < 0.05, **p < 0.01 by Student’s t test).
Shrna Lentiviral Vectors Targeting Mouse Flcn, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+lentiviral+vectors/pmc08459211-468-16-29?v=VectorBuilder+GmbH
Average 90 stars, based on 1 article reviews
shrna lentiviral vectors targeting mouse flcn - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Broad Institute Inc plko.1puro lentiviral vectors containing shrnas for mouse crep
(A and B) Detection of phagocytic activity of RAW 264.7 cells expressing a <t>control</t> <t>shRNA</t> or an shRNA targeting <t>Flcn</t> against pHrodo-SE-labeled untreated or heat-treated (for 3 min at 60°C) bone marrow cells (BMC) by flow cytometry. Representative fluorescence-activated cell sorting (FACS) plots are shown (A). Mean fluorescence intensities (MFIs) of pHrodo red in ZsGreen1-positive RAW cells were analyzed and are graphically represented (B) (n = 4; *p < 0.05, **p < 0.01 by Student’s t test).
Plko.1puro Lentiviral Vectors Containing Shrnas For Mouse Crep, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+lentiviral+vectors/pmc04508316-66-0-21?v=Broad+Institute+Inc
Average 90 stars, based on 1 article reviews
plko.1puro lentiviral vectors containing shrnas for mouse crep - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma lentiviral shrna vectors targeting human flii
(A and B) Detection of phagocytic activity of RAW 264.7 cells expressing a <t>control</t> <t>shRNA</t> or an shRNA targeting <t>Flcn</t> against pHrodo-SE-labeled untreated or heat-treated (for 3 min at 60°C) bone marrow cells (BMC) by flow cytometry. Representative fluorescence-activated cell sorting (FACS) plots are shown (A). Mean fluorescence intensities (MFIs) of pHrodo red in ZsGreen1-positive RAW cells were analyzed and are graphically represented (B) (n = 4; *p < 0.05, **p < 0.01 by Student’s t test).
Lentiviral Shrna Vectors Targeting Human Flii, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+lentiviral+vectors/pm28498392-52-0-3?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
lentiviral shrna vectors targeting human flii - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma lentiviral vectors containing shrna for cstb
(A and B) Detection of phagocytic activity of RAW 264.7 cells expressing a <t>control</t> <t>shRNA</t> or an shRNA targeting <t>Flcn</t> against pHrodo-SE-labeled untreated or heat-treated (for 3 min at 60°C) bone marrow cells (BMC) by flow cytometry. Representative fluorescence-activated cell sorting (FACS) plots are shown (A). Mean fluorescence intensities (MFIs) of pHrodo red in ZsGreen1-positive RAW cells were analyzed and are graphically represented (B) (n = 4; *p < 0.05, **p < 0.01 by Student’s t test).
Lentiviral Vectors Containing Shrna For Cstb, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+lentiviral+vectors/pm31180557-62-3-16?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
lentiviral vectors containing shrna for cstb - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH lentiviral vectors containing short hairpin rnas (shrna) specific for dhx36 and the control shrna (scr shrna)
Clinical significance of <t>DHX36</t> in lung cancer. (A) Overall survival analysis of DHX36 in lung cancer using the Kaplan-Meier plotter ( https://kmplot.com ). The probes of DHX36 were 223138_s_at, 223139_s_at and 223140_s_at. The patients were split by Auto select best cut-off. The number of eligible patients was n=1144. The breakdown meta-analysis of survival analysis in LUAD (B) and LUSC (C) was performed using the Lung Cancer Explorer ( http://lce.biohpc.swmed.edu ), which integrated the following eligible genomic data of GSE72094 (n=442), TCGA (LUAD, n=576; LUSC, n=552), GSE30219 (n=307), GSE41271 (n=275), GSE31210 (n=224), GSE31210 (224), GSE37745 (n=196), GSE50081 (n=181), GSE42127 (n=176), GSE11969 (n=163), GSE19188 (n=156), GSE13213 (n=117), GSE3141 (n=111), GSE74777 (107), GSE26939 (n=101), GSE1037 (n=80), GSE29016 (n=72), GSE12472 (n=63), GSE31548 (n=50), GSE10245 (n=48) and GSE11117 (44). (D) Differential expression of DHX36 gene between tumour and normal tissues in NSCLC. (E) Differential expression of DHX36 gene between tumour and normal tissues in LUAD. (F) Differential expression of DHX36 gene between tumour and normal tissues in LUSC. (G) Differential expression of DHX36 gene among T staging types in NSCLC. (H) Differential expression of DHX36 gene among N staging types in NSCLC. (I) Differential expression of DHX36 gene among M staging types in NSCLC.
Lentiviral Vectors Containing Short Hairpin Rnas (Shrna) Specific For Dhx36 And The Control Shrna (Scr Shrna), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+lentiviral+vectors/pmc08111079-64-9-19?v=VectorBuilder+GmbH
Average 90 stars, based on 1 article reviews
lentiviral vectors containing short hairpin rnas (shrna) specific for dhx36 and the control shrna (scr shrna) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH lentivirus: scrambled- and tβriii-targeted lentiviral shrna expression vectors with predesigned sequences including puromycin-resistant gene
Clinical significance of <t>DHX36</t> in lung cancer. (A) Overall survival analysis of DHX36 in lung cancer using the Kaplan-Meier plotter ( https://kmplot.com ). The probes of DHX36 were 223138_s_at, 223139_s_at and 223140_s_at. The patients were split by Auto select best cut-off. The number of eligible patients was n=1144. The breakdown meta-analysis of survival analysis in LUAD (B) and LUSC (C) was performed using the Lung Cancer Explorer ( http://lce.biohpc.swmed.edu ), which integrated the following eligible genomic data of GSE72094 (n=442), TCGA (LUAD, n=576; LUSC, n=552), GSE30219 (n=307), GSE41271 (n=275), GSE31210 (n=224), GSE31210 (224), GSE37745 (n=196), GSE50081 (n=181), GSE42127 (n=176), GSE11969 (n=163), GSE19188 (n=156), GSE13213 (n=117), GSE3141 (n=111), GSE74777 (107), GSE26939 (n=101), GSE1037 (n=80), GSE29016 (n=72), GSE12472 (n=63), GSE31548 (n=50), GSE10245 (n=48) and GSE11117 (44). (D) Differential expression of DHX36 gene between tumour and normal tissues in NSCLC. (E) Differential expression of DHX36 gene between tumour and normal tissues in LUAD. (F) Differential expression of DHX36 gene between tumour and normal tissues in LUSC. (G) Differential expression of DHX36 gene among T staging types in NSCLC. (H) Differential expression of DHX36 gene among N staging types in NSCLC. (I) Differential expression of DHX36 gene among M staging types in NSCLC.
Lentivirus: Scrambled And Tβriii Targeted Lentiviral Shrna Expression Vectors With Predesigned Sequences Including Puromycin Resistant Gene, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+lentiviral+vectors/pm39481440-347-17-21?v=VectorBuilder+GmbH
Average 90 stars, based on 1 article reviews
lentivirus: scrambled- and tβriii-targeted lentiviral shrna expression vectors with predesigned sequences including puromycin-resistant gene - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma lentiviral vectors full length bc200 gene
Expression of <t>BC200</t> in normal esophageal squamous epithelial cells and ESCC cell lines with different degrees of differentiation and infiltration ability assayed by qRT-PCR. The relative amount of BC200 was normalized to GAPDH. Data were analyzed using the 2 −ΔΔCT method. The relative expression of BC200 in different cell lines was normalized to normal esophageal squamous epithelial cells. Compared with normal esophageal squamous epithelial cells, the expression level of BC200 in ESCC cell lines was significantly increased and expression levels of BC200 in the poorly differentiated cell lines KYSE70, KYSE150, and KYSE410 were significantly higher than the differentiated cell lines EC9706, KYSE450, and KYSE510. Data are expressed as representative of three independent experiments. * p < 0.05, *** p < 0.01; error bars correspond to the mean ± SD.
Lentiviral Vectors Full Length Bc200 Gene, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+lentiviral+vectors/pmc07468420-29-4-28?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
lentiviral vectors full length bc200 gene - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH foxo3 and znf281 overexpression constructs
Single‐cell transcriptomic analysis uncovers the characteristics of the aging corneal epithelium. (a) The schematic representation showing the single‐cell RNA sequencing (scRNA‐seq) analysis pipeline, which includes a comparative study of aging changes in the monkey corneal epithelium and across different organs (including hippocampus, lung, heart from monkeys, and bone and skin from humans). This representation also compares the aging process in the corneal epithelium across various species. (b) UMAP plot showing the seven cell types comprising primate corneal epithelium. LSCs, limbal stem cells; TACs, transit amplifying cells; MKI67+, PMCs, postmitotic cell; TDCs, terminally differentiated cells; Conj‐1, conjunctival epithelial cells‐1; Conj‐2, conjunctival epithelial cells‐2; MCs, melanocytes. (c) Heatmap showing the expression signature of the top 30 marker genes for each identified cell type. (d) Violin plots of gene set scores related to the SASP in young and aged groups. (e) Network visualization of core regulatory TFs in the 7 cell types in corneal epithelium between the old and young groups. (f) Volcano plots indicating that aging upregulates ZNF281 and <t>FOXO3</t> in PMC of the corneal epithelium. (g) Dot plot showing the enriched GO term of ZNF281 target genes. (h) Dot plots showing the variation in ZNF281 expression during aging across different organ. Oligo, oligodendrocyte; Vip, VIP+ neuron; MuSC, muscle stem cell; CapEC, Capillary endothelial cell; SMC, smooth muscle cell. (i) Bubble plot showing the expression of ZNF281 target genes is uniquely upregulated in the stem cell in aging corneal epithelium. (j) Dot plot showing genes exhibiting oxidant capacity are specifically upregulated within stem cells in the aging corneal epithelium.
Foxo3 And Znf281 Overexpression Constructs, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+lentiviral+vectors/pmc11634732-129-12-22?v=VectorBuilder+GmbH
Average 90 stars, based on 1 article reviews
foxo3 and znf281 overexpression constructs - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH lentiviral vectors shrna_dhx34#2
Single‐cell transcriptomic analysis uncovers the characteristics of the aging corneal epithelium. (a) The schematic representation showing the single‐cell RNA sequencing (scRNA‐seq) analysis pipeline, which includes a comparative study of aging changes in the monkey corneal epithelium and across different organs (including hippocampus, lung, heart from monkeys, and bone and skin from humans). This representation also compares the aging process in the corneal epithelium across various species. (b) UMAP plot showing the seven cell types comprising primate corneal epithelium. LSCs, limbal stem cells; TACs, transit amplifying cells; MKI67+, PMCs, postmitotic cell; TDCs, terminally differentiated cells; Conj‐1, conjunctival epithelial cells‐1; Conj‐2, conjunctival epithelial cells‐2; MCs, melanocytes. (c) Heatmap showing the expression signature of the top 30 marker genes for each identified cell type. (d) Violin plots of gene set scores related to the SASP in young and aged groups. (e) Network visualization of core regulatory TFs in the 7 cell types in corneal epithelium between the old and young groups. (f) Volcano plots indicating that aging upregulates ZNF281 and <t>FOXO3</t> in PMC of the corneal epithelium. (g) Dot plot showing the enriched GO term of ZNF281 target genes. (h) Dot plots showing the variation in ZNF281 expression during aging across different organ. Oligo, oligodendrocyte; Vip, VIP+ neuron; MuSC, muscle stem cell; CapEC, Capillary endothelial cell; SMC, smooth muscle cell. (i) Bubble plot showing the expression of ZNF281 target genes is uniquely upregulated in the stem cell in aging corneal epithelium. (j) Dot plot showing genes exhibiting oxidant capacity are specifically upregulated within stem cells in the aging corneal epithelium.
Lentiviral Vectors Shrna Dhx34#2, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+lentiviral+vectors/pmc09380745-222-3-23?v=VectorBuilder+GmbH
Average 90 stars, based on 1 article reviews
lentiviral vectors shrna_dhx34#2 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma lentiviral vectors carrying gfp and either shrna targeting gpr171 mrna or a non-targeting control shrna
GPR171 partially mediates CCL2 production via the ERK1/2 pathway. (A–C) GPR171 expression was verified in GPR171‐knockdown RBL‐2H3 cells by RT‐qPCR and western blotting. (D) Percentage of β‐hexosaminidase released into the supernatants from control <t>shRNA‐treated</t> and GPR171 shRNA‐treated RBL‐2H3 cells in response to H. pylori infection. (E) The mRNA levels of the 6 cytokines in control shRNA‐treated and GPR171 shRNA‐treated cells stimulated with H. pylori . (F) CCL2 levels in the supernatants of shRNA‐treated and GPR171 shRNA‐treated RBL‐2H3 cells co‐cultured with H. pylori . (G) GO enrichment of DEGs based on RNA‐seq data. (H) Immunoblot analysis and quantification of ERK1/2 phosphorylation in RBL‐2H3 cells that were or were not treated with H. pylori . p‐ERK expression was normalized to total ERK. (I) RT‐qPCR analysis of CCL2 mRNA expression in mast cells co‐cultured with or without H. pylori . (J) CCL2 levels in supernatants were quantified by ELISA. Cells were pretreated with 5 μM U0126 as indicated (H–J). (K) Immunoblot analysis and quantification of p‐ERK in control shRNA‐treated and GPR171 shRNA‐treated cells following H. pylori stimulation. (L, M) Western blot analysis of ERK1/2 phosphorylation expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . (N, O) RT‐qPCR and ELISA analysis of CCL2 expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . MS21570: A blocker of GPR171. Statistical significance was determined by Student's unpaired t ‐test (A, C, D, E, F, K) and one‐way ANOVA (H, I, J, M, N, O), * p < 0.05, ** p < 0.01, *** p < 0.001.
Lentiviral Vectors Carrying Gfp And Either Shrna Targeting Gpr171 Mrna Or A Non Targeting Control Shrna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+lentiviral+vectors/pmc12050395-122-12-17?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
lentiviral vectors carrying gfp and either shrna targeting gpr171 mrna or a non-targeting control shrna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


(A and B) Detection of phagocytic activity of RAW 264.7 cells expressing a control shRNA or an shRNA targeting Flcn against pHrodo-SE-labeled untreated or heat-treated (for 3 min at 60°C) bone marrow cells (BMC) by flow cytometry. Representative fluorescence-activated cell sorting (FACS) plots are shown (A). Mean fluorescence intensities (MFIs) of pHrodo red in ZsGreen1-positive RAW cells were analyzed and are graphically represented (B) (n = 4; *p < 0.05, **p < 0.01 by Student’s t test).

Journal: Cell reports

Article Title: A FLCN-TFE3 Feedback Loop Prevents Excessive Glycogenesis and Phagocyte Activation by Regulating Lysosome Activity

doi: 10.1016/j.celrep.2020.01.042

Figure Lengend Snippet: (A and B) Detection of phagocytic activity of RAW 264.7 cells expressing a control shRNA or an shRNA targeting Flcn against pHrodo-SE-labeled untreated or heat-treated (for 3 min at 60°C) bone marrow cells (BMC) by flow cytometry. Representative fluorescence-activated cell sorting (FACS) plots are shown (A). Mean fluorescence intensities (MFIs) of pHrodo red in ZsGreen1-positive RAW cells were analyzed and are graphically represented (B) (n = 4; *p < 0.05, **p < 0.01 by Student’s t test).

Article Snippet: See Table S1 for primer sequences. shRNA Knockdown in RAW 264.7 Cells shRNA lentiviral vectors targeting mouse Flcn (target sequence: GCTTCAAGTCTCTTCGACACAT) and Tfe3 (target sequence: GCCTAACATCAAACGCGAGAT) were purchased from VectorBuilder (Santa Clara, CA).

Techniques: Activity Assay, Expressing, Control, shRNA, Labeling, Flow Cytometry, Fluorescence, FACS

(A) Flcn transcript levels in RAW cells expressing either a control or TFE3-GR construct and cultured with (+) or without (−) Dex for 2 days were determined by quantitative RT-PCR and normalized to Actb levels. Bars represent fold-change of values relative to Dex-untreated control cells (mean ± SD; *p ≤ 0.05, **p ≤ 0.01 by Student’s t test).

Journal: Cell reports

Article Title: A FLCN-TFE3 Feedback Loop Prevents Excessive Glycogenesis and Phagocyte Activation by Regulating Lysosome Activity

doi: 10.1016/j.celrep.2020.01.042

Figure Lengend Snippet: (A) Flcn transcript levels in RAW cells expressing either a control or TFE3-GR construct and cultured with (+) or without (−) Dex for 2 days were determined by quantitative RT-PCR and normalized to Actb levels. Bars represent fold-change of values relative to Dex-untreated control cells (mean ± SD; *p ≤ 0.05, **p ≤ 0.01 by Student’s t test).

Article Snippet: See Table S1 for primer sequences. shRNA Knockdown in RAW 264.7 Cells shRNA lentiviral vectors targeting mouse Flcn (target sequence: GCTTCAAGTCTCTTCGACACAT) and Tfe3 (target sequence: GCCTAACATCAAACGCGAGAT) were purchased from VectorBuilder (Santa Clara, CA).

Techniques: Expressing, Control, Construct, Cell Culture, Quantitative RT-PCR

(A) Kaplan-Meier survival analysis demonstrating Tfe3 allele dose-dependent rescue of Flcnf/f;Vav-iCreTg/+ (Flcn-KO) mouse survival. Flcnf/f;Vav-iCreTg/+;Tfe3−/+ (female) mice are indicated as “Flcn-KO;Tfe3−/+”. Flcnf/f;Vav-iCreTg/+;Tfe3−/y (male) and Flcnf/f;Vav-iCreTg/+;Tfe3−/− (female) mice are indicated as “dKO” (**p ≤ 0.01, log-rank test). See Figure S5A for more details.

Journal: Cell reports

Article Title: A FLCN-TFE3 Feedback Loop Prevents Excessive Glycogenesis and Phagocyte Activation by Regulating Lysosome Activity

doi: 10.1016/j.celrep.2020.01.042

Figure Lengend Snippet: (A) Kaplan-Meier survival analysis demonstrating Tfe3 allele dose-dependent rescue of Flcnf/f;Vav-iCreTg/+ (Flcn-KO) mouse survival. Flcnf/f;Vav-iCreTg/+;Tfe3−/+ (female) mice are indicated as “Flcn-KO;Tfe3−/+”. Flcnf/f;Vav-iCreTg/+;Tfe3−/y (male) and Flcnf/f;Vav-iCreTg/+;Tfe3−/− (female) mice are indicated as “dKO” (**p ≤ 0.01, log-rank test). See Figure S5A for more details.

Article Snippet: See Table S1 for primer sequences. shRNA Knockdown in RAW 264.7 Cells shRNA lentiviral vectors targeting mouse Flcn (target sequence: GCTTCAAGTCTCTTCGACACAT) and Tfe3 (target sequence: GCCTAACATCAAACGCGAGAT) were purchased from VectorBuilder (Santa Clara, CA).

Techniques:

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: A FLCN-TFE3 Feedback Loop Prevents Excessive Glycogenesis and Phagocyte Activation by Regulating Lysosome Activity

doi: 10.1016/j.celrep.2020.01.042

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: See Table S1 for primer sequences. shRNA Knockdown in RAW 264.7 Cells shRNA lentiviral vectors targeting mouse Flcn (target sequence: GCTTCAAGTCTCTTCGACACAT) and Tfe3 (target sequence: GCCTAACATCAAACGCGAGAT) were purchased from VectorBuilder (Santa Clara, CA).

Techniques: Purification, Blocking Assay, Recombinant, Transfection, Flow Cytometry, Magnetic Beads, Lysis, Extraction, SYBR Green Assay, Staining, shRNA, Sequencing, Plasmid Preparation, Software

Clinical significance of DHX36 in lung cancer. (A) Overall survival analysis of DHX36 in lung cancer using the Kaplan-Meier plotter ( https://kmplot.com ). The probes of DHX36 were 223138_s_at, 223139_s_at and 223140_s_at. The patients were split by Auto select best cut-off. The number of eligible patients was n=1144. The breakdown meta-analysis of survival analysis in LUAD (B) and LUSC (C) was performed using the Lung Cancer Explorer ( http://lce.biohpc.swmed.edu ), which integrated the following eligible genomic data of GSE72094 (n=442), TCGA (LUAD, n=576; LUSC, n=552), GSE30219 (n=307), GSE41271 (n=275), GSE31210 (n=224), GSE31210 (224), GSE37745 (n=196), GSE50081 (n=181), GSE42127 (n=176), GSE11969 (n=163), GSE19188 (n=156), GSE13213 (n=117), GSE3141 (n=111), GSE74777 (107), GSE26939 (n=101), GSE1037 (n=80), GSE29016 (n=72), GSE12472 (n=63), GSE31548 (n=50), GSE10245 (n=48) and GSE11117 (44). (D) Differential expression of DHX36 gene between tumour and normal tissues in NSCLC. (E) Differential expression of DHX36 gene between tumour and normal tissues in LUAD. (F) Differential expression of DHX36 gene between tumour and normal tissues in LUSC. (G) Differential expression of DHX36 gene among T staging types in NSCLC. (H) Differential expression of DHX36 gene among N staging types in NSCLC. (I) Differential expression of DHX36 gene among M staging types in NSCLC.

Journal: Frontiers in Oncology

Article Title: The G4 Resolvase DHX36 Possesses a Prognosis Significance and Exerts Tumour Suppressing Function Through Multiple Causal Regulations in Non-Small Cell Lung Cancer

doi: 10.3389/fonc.2021.655757

Figure Lengend Snippet: Clinical significance of DHX36 in lung cancer. (A) Overall survival analysis of DHX36 in lung cancer using the Kaplan-Meier plotter ( https://kmplot.com ). The probes of DHX36 were 223138_s_at, 223139_s_at and 223140_s_at. The patients were split by Auto select best cut-off. The number of eligible patients was n=1144. The breakdown meta-analysis of survival analysis in LUAD (B) and LUSC (C) was performed using the Lung Cancer Explorer ( http://lce.biohpc.swmed.edu ), which integrated the following eligible genomic data of GSE72094 (n=442), TCGA (LUAD, n=576; LUSC, n=552), GSE30219 (n=307), GSE41271 (n=275), GSE31210 (n=224), GSE31210 (224), GSE37745 (n=196), GSE50081 (n=181), GSE42127 (n=176), GSE11969 (n=163), GSE19188 (n=156), GSE13213 (n=117), GSE3141 (n=111), GSE74777 (107), GSE26939 (n=101), GSE1037 (n=80), GSE29016 (n=72), GSE12472 (n=63), GSE31548 (n=50), GSE10245 (n=48) and GSE11117 (44). (D) Differential expression of DHX36 gene between tumour and normal tissues in NSCLC. (E) Differential expression of DHX36 gene between tumour and normal tissues in LUAD. (F) Differential expression of DHX36 gene between tumour and normal tissues in LUSC. (G) Differential expression of DHX36 gene among T staging types in NSCLC. (H) Differential expression of DHX36 gene among N staging types in NSCLC. (I) Differential expression of DHX36 gene among M staging types in NSCLC.

Article Snippet: Lentiviral vectors containing short hairpin RNAs (shRNA) specific for DHX36 and the control shRNA (Scr shRNA) were obtained from VectorBuilder (Santa Clara, CA, USA).

Techniques: Quantitative Proteomics

Validation of the stable cell lines with DHX36 shRNAs. Gene expression in A549 (A) and SK-MES-1 (B) . Flow cytometry analysis of DHX36 protein expression in A549 containing SCR (C) , A549 containing DHX36 shRNA1 (D) , A549 containing DHX36 shRNA2 (E) , SK-MES-1 containing SCR (F) , SK-MES-1 containing DHX36 shRNA1 (G) , SK-MES-1 containing DHX36 shRNA1 (H) . Western blots of DHX36 protein in A549 (I) and SK-MES-1 (J) .

Journal: Frontiers in Oncology

Article Title: The G4 Resolvase DHX36 Possesses a Prognosis Significance and Exerts Tumour Suppressing Function Through Multiple Causal Regulations in Non-Small Cell Lung Cancer

doi: 10.3389/fonc.2021.655757

Figure Lengend Snippet: Validation of the stable cell lines with DHX36 shRNAs. Gene expression in A549 (A) and SK-MES-1 (B) . Flow cytometry analysis of DHX36 protein expression in A549 containing SCR (C) , A549 containing DHX36 shRNA1 (D) , A549 containing DHX36 shRNA2 (E) , SK-MES-1 containing SCR (F) , SK-MES-1 containing DHX36 shRNA1 (G) , SK-MES-1 containing DHX36 shRNA1 (H) . Western blots of DHX36 protein in A549 (I) and SK-MES-1 (J) .

Article Snippet: Lentiviral vectors containing short hairpin RNAs (shRNA) specific for DHX36 and the control shRNA (Scr shRNA) were obtained from VectorBuilder (Santa Clara, CA, USA).

Techniques: Biomarker Discovery, Stable Transfection, Gene Expression, Flow Cytometry, Expressing, Western Blot

The effect of the knockdown of the DHX36 gene on cell migration, cell cycle and apoptosis. The migration was monitored by the ECIS system in the stable cell lines derived from A549 (A) and SK-MES-1 (B) . (C) Cell cycle analysis of A549 SCR. (D) Cell cycle analysis of A549 DHX36 KD. (E) Cell cycle analysis of SK-MES-1 SCR. (F) Cell cycle analysis of SK-MES-1 KD. (G) Apoptosis of the A549 SCR treated with PBS. (H) Apoptosis of the A549 DHX36 KD treated with cisplatin (10 µM, 24 h). (I) Apoptosis of the SK-MES-1 DHX36 KD treated with PBS. (J) Apoptosis of the SK-MES-1 DHX36 KD treated with cisplatin.

Journal: Frontiers in Oncology

Article Title: The G4 Resolvase DHX36 Possesses a Prognosis Significance and Exerts Tumour Suppressing Function Through Multiple Causal Regulations in Non-Small Cell Lung Cancer

doi: 10.3389/fonc.2021.655757

Figure Lengend Snippet: The effect of the knockdown of the DHX36 gene on cell migration, cell cycle and apoptosis. The migration was monitored by the ECIS system in the stable cell lines derived from A549 (A) and SK-MES-1 (B) . (C) Cell cycle analysis of A549 SCR. (D) Cell cycle analysis of A549 DHX36 KD. (E) Cell cycle analysis of SK-MES-1 SCR. (F) Cell cycle analysis of SK-MES-1 KD. (G) Apoptosis of the A549 SCR treated with PBS. (H) Apoptosis of the A549 DHX36 KD treated with cisplatin (10 µM, 24 h). (I) Apoptosis of the SK-MES-1 DHX36 KD treated with PBS. (J) Apoptosis of the SK-MES-1 DHX36 KD treated with cisplatin.

Article Snippet: Lentiviral vectors containing short hairpin RNAs (shRNA) specific for DHX36 and the control shRNA (Scr shRNA) were obtained from VectorBuilder (Santa Clara, CA, USA).

Techniques: Knockdown, Migration, Stable Transfection, Derivative Assay, Cell Cycle Assay

Kinex antibody microarray analysis of signal transduction after DHX36 was knocked down in A549 cells. (A) Upregulated proteins with z ratio>1 (B) Downregulated proteins with z ratio<-1 (C) Heatmaps of the Kinex antibody arrays. (D) Key signalling pathways identified using the clusterProfiler Bioconductor package in R language.

Journal: Frontiers in Oncology

Article Title: The G4 Resolvase DHX36 Possesses a Prognosis Significance and Exerts Tumour Suppressing Function Through Multiple Causal Regulations in Non-Small Cell Lung Cancer

doi: 10.3389/fonc.2021.655757

Figure Lengend Snippet: Kinex antibody microarray analysis of signal transduction after DHX36 was knocked down in A549 cells. (A) Upregulated proteins with z ratio>1 (B) Downregulated proteins with z ratio<-1 (C) Heatmaps of the Kinex antibody arrays. (D) Key signalling pathways identified using the clusterProfiler Bioconductor package in R language.

Article Snippet: Lentiviral vectors containing short hairpin RNAs (shRNA) specific for DHX36 and the control shRNA (Scr shRNA) were obtained from VectorBuilder (Santa Clara, CA, USA).

Techniques: Microarray, Transduction

Heatmap plotting and causal pathway analysis of the differential transcript profiles affected by DHX36 in LUAD and LUSC. The bioinformatic analysis was conducted using the Pathview Bioconductor package in R. The lung cancer RNA-Seq datasets were obtained from TCGA. (A) Heatmap visualisation of the differential transcripts affected by DHX36. (B) Causal gene set enrichment analysis in LUAD. (C) Causal gene set enrichment analysis in LUSC. The enrichment scores were obtained using multiplex pathway databases including Gene ontology terms (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) and the Molecular Signatures Database (MSigDB) HALLMARK sets. nlgpval is the abbreviation of the negative log of p value.

Journal: Frontiers in Oncology

Article Title: The G4 Resolvase DHX36 Possesses a Prognosis Significance and Exerts Tumour Suppressing Function Through Multiple Causal Regulations in Non-Small Cell Lung Cancer

doi: 10.3389/fonc.2021.655757

Figure Lengend Snippet: Heatmap plotting and causal pathway analysis of the differential transcript profiles affected by DHX36 in LUAD and LUSC. The bioinformatic analysis was conducted using the Pathview Bioconductor package in R. The lung cancer RNA-Seq datasets were obtained from TCGA. (A) Heatmap visualisation of the differential transcripts affected by DHX36. (B) Causal gene set enrichment analysis in LUAD. (C) Causal gene set enrichment analysis in LUSC. The enrichment scores were obtained using multiplex pathway databases including Gene ontology terms (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) and the Molecular Signatures Database (MSigDB) HALLMARK sets. nlgpval is the abbreviation of the negative log of p value.

Article Snippet: Lentiviral vectors containing short hairpin RNAs (shRNA) specific for DHX36 and the control shRNA (Scr shRNA) were obtained from VectorBuilder (Santa Clara, CA, USA).

Techniques: RNA Sequencing, Multiplex Assay

Expression of BC200 in normal esophageal squamous epithelial cells and ESCC cell lines with different degrees of differentiation and infiltration ability assayed by qRT-PCR. The relative amount of BC200 was normalized to GAPDH. Data were analyzed using the 2 −ΔΔCT method. The relative expression of BC200 in different cell lines was normalized to normal esophageal squamous epithelial cells. Compared with normal esophageal squamous epithelial cells, the expression level of BC200 in ESCC cell lines was significantly increased and expression levels of BC200 in the poorly differentiated cell lines KYSE70, KYSE150, and KYSE410 were significantly higher than the differentiated cell lines EC9706, KYSE450, and KYSE510. Data are expressed as representative of three independent experiments. * p < 0.05, *** p < 0.01; error bars correspond to the mean ± SD.

Journal: Frontiers in Oncology

Article Title: LncRNA BC200 Promotes Esophageal Squamous Cell Cancer Migration and Invasion and Can Regulate ATF4 Expression

doi: 10.3389/fonc.2020.01392

Figure Lengend Snippet: Expression of BC200 in normal esophageal squamous epithelial cells and ESCC cell lines with different degrees of differentiation and infiltration ability assayed by qRT-PCR. The relative amount of BC200 was normalized to GAPDH. Data were analyzed using the 2 −ΔΔCT method. The relative expression of BC200 in different cell lines was normalized to normal esophageal squamous epithelial cells. Compared with normal esophageal squamous epithelial cells, the expression level of BC200 in ESCC cell lines was significantly increased and expression levels of BC200 in the poorly differentiated cell lines KYSE70, KYSE150, and KYSE410 were significantly higher than the differentiated cell lines EC9706, KYSE450, and KYSE510. Data are expressed as representative of three independent experiments. * p < 0.05, *** p < 0.01; error bars correspond to the mean ± SD.

Article Snippet: The lentiviral vectors including BC200 shRNA (LV-BC200-shRNA, KD), the full length of BC200 gene (LV-BC200, BC200), or negative control (CON053, NC) were constructed using the pGCSIL-004-hU6-CMV-EGF(GV115) vector by GenePharma Co (Shanghai, China).

Techniques: Expressing, Quantitative RT-PCR

The efficiency of LV-BC200-shRNA (KD)-mediated knockdown of BC200 in ESCC KYSE70 and KYSE410 cells and LV-BC200 (BC200) mediated overexpression of BC200 in EC9706 cells. After transduction of lentiviral vectors including BC200 shRNA (LV-BC200-shRNA, KD) or negative control (CON053, NC) in KYSE70 cells and KYSE410 cells and BC200 gene (LV-BC200, BC200) in EC9706 cells, fluorescence microscope was used to observe the expression of green fluorescent protein (GFP) to estimate the infection efficiency. Fluorescence microscope pictures (200× magnification) that were taken after 72 h of transduction in KYSE70 cells (A) , KYSE410 cells (C) , and EC9706 cells (E) . If the infection rate reached 70%, expression of BC200 was then assessed by qRT-PCR (relative to GAPDH) in KYSE70 cells (B) , KYSE410 cells (D) , and EC9706 cells (F) . The data showed that BC200 expression was significantly downregulated in the KD group compared with the NC group and increased in the BC200 groups compared with the NC group. Data are expressed as representative of three independent experiments. * p < 0.05; error bars correspond to the mean ± SD.

Journal: Frontiers in Oncology

Article Title: LncRNA BC200 Promotes Esophageal Squamous Cell Cancer Migration and Invasion and Can Regulate ATF4 Expression

doi: 10.3389/fonc.2020.01392

Figure Lengend Snippet: The efficiency of LV-BC200-shRNA (KD)-mediated knockdown of BC200 in ESCC KYSE70 and KYSE410 cells and LV-BC200 (BC200) mediated overexpression of BC200 in EC9706 cells. After transduction of lentiviral vectors including BC200 shRNA (LV-BC200-shRNA, KD) or negative control (CON053, NC) in KYSE70 cells and KYSE410 cells and BC200 gene (LV-BC200, BC200) in EC9706 cells, fluorescence microscope was used to observe the expression of green fluorescent protein (GFP) to estimate the infection efficiency. Fluorescence microscope pictures (200× magnification) that were taken after 72 h of transduction in KYSE70 cells (A) , KYSE410 cells (C) , and EC9706 cells (E) . If the infection rate reached 70%, expression of BC200 was then assessed by qRT-PCR (relative to GAPDH) in KYSE70 cells (B) , KYSE410 cells (D) , and EC9706 cells (F) . The data showed that BC200 expression was significantly downregulated in the KD group compared with the NC group and increased in the BC200 groups compared with the NC group. Data are expressed as representative of three independent experiments. * p < 0.05; error bars correspond to the mean ± SD.

Article Snippet: The lentiviral vectors including BC200 shRNA (LV-BC200-shRNA, KD), the full length of BC200 gene (LV-BC200, BC200), or negative control (CON053, NC) were constructed using the pGCSIL-004-hU6-CMV-EGF(GV115) vector by GenePharma Co (Shanghai, China).

Techniques: shRNA, Knockdown, Over Expression, Transduction, Negative Control, Fluorescence, Microscopy, Expressing, Infection, Quantitative RT-PCR

BC200 knockdown reduced the migration of ESCC cells. ESCC cells transfected with BC200 shRNA (KD) or negative control (NC) were assessed by wound healing assay. Transduced cells were cultured until they reached 90% confluence and then were wounded. Photographs were collected at 0 h, 24 h, and 48 h after wounding. (A,C) Representative photos of wound healing (20× magnification) in KYSE70 (A) and KYSE410 (C) cells. (C,D) Quantitative analyses of the migration rate in KYSE70 (C) and KYSE410 (D) cells. The migration rate was calculated by the ratio of migration distance at different observation time points to the width value at 0 h. Our data showed that the migration rate of KD cells was reduced to 30–40% of that of NC cells. Data are expressed as the mean ± SD of triplicates; * p < 0.05.

Journal: Frontiers in Oncology

Article Title: LncRNA BC200 Promotes Esophageal Squamous Cell Cancer Migration and Invasion and Can Regulate ATF4 Expression

doi: 10.3389/fonc.2020.01392

Figure Lengend Snippet: BC200 knockdown reduced the migration of ESCC cells. ESCC cells transfected with BC200 shRNA (KD) or negative control (NC) were assessed by wound healing assay. Transduced cells were cultured until they reached 90% confluence and then were wounded. Photographs were collected at 0 h, 24 h, and 48 h after wounding. (A,C) Representative photos of wound healing (20× magnification) in KYSE70 (A) and KYSE410 (C) cells. (C,D) Quantitative analyses of the migration rate in KYSE70 (C) and KYSE410 (D) cells. The migration rate was calculated by the ratio of migration distance at different observation time points to the width value at 0 h. Our data showed that the migration rate of KD cells was reduced to 30–40% of that of NC cells. Data are expressed as the mean ± SD of triplicates; * p < 0.05.

Article Snippet: The lentiviral vectors including BC200 shRNA (LV-BC200-shRNA, KD), the full length of BC200 gene (LV-BC200, BC200), or negative control (CON053, NC) were constructed using the pGCSIL-004-hU6-CMV-EGF(GV115) vector by GenePharma Co (Shanghai, China).

Techniques: Knockdown, Migration, Transfection, shRNA, Negative Control, Wound Healing Assay, Cell Culture

BC200 overexpression promoted the migration but not the proliferation of ESCC cells. ESCC cells EC9706 transfected with BC200 or negative control (NC) were assessed by wound healing assay (A,B) , Boyden chambers coated with Matrigel (C,D) and MTT assay (E) . Transduced cells were cultured until they reached 90% confluence and then were wounded. Photographs were collected at 0, 24, and 48 h after wounding. (A) Representative photos of wound healing (20× magnification) in EC9706 cells. (B) Quantitative analyses of the migration rate in EC9706 cells. The migration rate was calculated by the ratio of migration distance at different observation time points to the width value at 0 h. Our data showed that the migration rate of BC200 cells was increased to about 1.5-fold of that of NC cells. Data are expressed as the mean ± SD of triplicates; * p < 0.05. (C) Representative photos of EC9706 cells are shown at 200× magnification under an inverted microscope. The migrated cells were counted from 10 randomly chosen fields. The data indicated that the invasion ability of BC200 cells was significantly increased than that of NC cells. * p < 0.05. Error bars correspond to the mean ± SD. (E) The proliferation of infected cells was measured at 24, 48, 72, 96, and 120 h by MTT assay. Viability was measured relative to untreated cells at each time point. It showed that the proliferation ability was not significantly different between the two groups. Data are expressed as the mean ± SD of triplicates.

Journal: Frontiers in Oncology

Article Title: LncRNA BC200 Promotes Esophageal Squamous Cell Cancer Migration and Invasion and Can Regulate ATF4 Expression

doi: 10.3389/fonc.2020.01392

Figure Lengend Snippet: BC200 overexpression promoted the migration but not the proliferation of ESCC cells. ESCC cells EC9706 transfected with BC200 or negative control (NC) were assessed by wound healing assay (A,B) , Boyden chambers coated with Matrigel (C,D) and MTT assay (E) . Transduced cells were cultured until they reached 90% confluence and then were wounded. Photographs were collected at 0, 24, and 48 h after wounding. (A) Representative photos of wound healing (20× magnification) in EC9706 cells. (B) Quantitative analyses of the migration rate in EC9706 cells. The migration rate was calculated by the ratio of migration distance at different observation time points to the width value at 0 h. Our data showed that the migration rate of BC200 cells was increased to about 1.5-fold of that of NC cells. Data are expressed as the mean ± SD of triplicates; * p < 0.05. (C) Representative photos of EC9706 cells are shown at 200× magnification under an inverted microscope. The migrated cells were counted from 10 randomly chosen fields. The data indicated that the invasion ability of BC200 cells was significantly increased than that of NC cells. * p < 0.05. Error bars correspond to the mean ± SD. (E) The proliferation of infected cells was measured at 24, 48, 72, 96, and 120 h by MTT assay. Viability was measured relative to untreated cells at each time point. It showed that the proliferation ability was not significantly different between the two groups. Data are expressed as the mean ± SD of triplicates.

Article Snippet: The lentiviral vectors including BC200 shRNA (LV-BC200-shRNA, KD), the full length of BC200 gene (LV-BC200, BC200), or negative control (CON053, NC) were constructed using the pGCSIL-004-hU6-CMV-EGF(GV115) vector by GenePharma Co (Shanghai, China).

Techniques: Over Expression, Migration, Transfection, Negative Control, Wound Healing Assay, MTT Assay, Cell Culture, Inverted Microscopy, Infection

BC200 knockdown reduced the migration but not the proliferation of ESCC cells. ESCC cells transfected with BC200 shRNA (KD) or negative control (NC) were assessed by Boyden chambers coated with Matrigel (A–D) and MTT assay (E,F) . (A,C) Representative photos of KYSE70 (A) and KYSE410 (B) cells are shown at 200× magnification under an inverted microscope. The migrated cells were counted from 10 randomly chosen fields. The data indicated that the invasion ability of KD cells was significantly decreased than that of NC cells. * p < 0.05. Error bars correspond to the mean ± SD. (E,F) The proliferation of infected cells was measured at 24 h, 48 h, 72 h, 96 h, and 120 h by MTT assay. Viability was measured relative to untreated cells at each time point. It showed that the proliferation ability was not significantly different between the two groups. Data are expressed as the mean ± SD of triplicates.

Journal: Frontiers in Oncology

Article Title: LncRNA BC200 Promotes Esophageal Squamous Cell Cancer Migration and Invasion and Can Regulate ATF4 Expression

doi: 10.3389/fonc.2020.01392

Figure Lengend Snippet: BC200 knockdown reduced the migration but not the proliferation of ESCC cells. ESCC cells transfected with BC200 shRNA (KD) or negative control (NC) were assessed by Boyden chambers coated with Matrigel (A–D) and MTT assay (E,F) . (A,C) Representative photos of KYSE70 (A) and KYSE410 (B) cells are shown at 200× magnification under an inverted microscope. The migrated cells were counted from 10 randomly chosen fields. The data indicated that the invasion ability of KD cells was significantly decreased than that of NC cells. * p < 0.05. Error bars correspond to the mean ± SD. (E,F) The proliferation of infected cells was measured at 24 h, 48 h, 72 h, 96 h, and 120 h by MTT assay. Viability was measured relative to untreated cells at each time point. It showed that the proliferation ability was not significantly different between the two groups. Data are expressed as the mean ± SD of triplicates.

Article Snippet: The lentiviral vectors including BC200 shRNA (LV-BC200-shRNA, KD), the full length of BC200 gene (LV-BC200, BC200), or negative control (CON053, NC) were constructed using the pGCSIL-004-hU6-CMV-EGF(GV115) vector by GenePharma Co (Shanghai, China).

Techniques: Knockdown, Migration, Transfection, shRNA, Negative Control, MTT Assay, Inverted Microscopy, Infection

BC200 knockdown suppressed tumor metastasis in vivo . KYSE70 cells harboring either BC200 shRNA (KD) or negative control (NC) were injected via the tail vein. The total radiant efficiency of each mouse was recorded, and then we dissected the mice and resected the lung and liver tissues after 61 days of injection. Metastasis was detected in all the animals by the small animal live imaging system. The total fluorescence expression of the KD group was significantly reduced to 10% of that of the NC group. The metastasis rate of the lung was 100%, but no metastases in the liver. Due to a large number of different size metastases in the NC and KD groups, statistical analysis of the number and weight of metastatic lesions could not be performed. Thus, we compared the weight of the lungs between the two groups, and the data showed that compared with the NC group, the lung weight of the KD group was significantly decreased. (A) Photos were taken via the small-animal live imaging system. (B) Quantitative analyses of total radiant efficiency in different groups. Data are expressed as the mean ± SD; * p < 0.05. (C) Photos of the lung tissues of mice covered with metastases. (D) Photos of the liver tissues of mice that had no metastases. (E) Quantitative analyses of the lung weight between the KD and NC groups. Data are expressed as the mean ± SD; * p < 0.05.

Journal: Frontiers in Oncology

Article Title: LncRNA BC200 Promotes Esophageal Squamous Cell Cancer Migration and Invasion and Can Regulate ATF4 Expression

doi: 10.3389/fonc.2020.01392

Figure Lengend Snippet: BC200 knockdown suppressed tumor metastasis in vivo . KYSE70 cells harboring either BC200 shRNA (KD) or negative control (NC) were injected via the tail vein. The total radiant efficiency of each mouse was recorded, and then we dissected the mice and resected the lung and liver tissues after 61 days of injection. Metastasis was detected in all the animals by the small animal live imaging system. The total fluorescence expression of the KD group was significantly reduced to 10% of that of the NC group. The metastasis rate of the lung was 100%, but no metastases in the liver. Due to a large number of different size metastases in the NC and KD groups, statistical analysis of the number and weight of metastatic lesions could not be performed. Thus, we compared the weight of the lungs between the two groups, and the data showed that compared with the NC group, the lung weight of the KD group was significantly decreased. (A) Photos were taken via the small-animal live imaging system. (B) Quantitative analyses of total radiant efficiency in different groups. Data are expressed as the mean ± SD; * p < 0.05. (C) Photos of the lung tissues of mice covered with metastases. (D) Photos of the liver tissues of mice that had no metastases. (E) Quantitative analyses of the lung weight between the KD and NC groups. Data are expressed as the mean ± SD; * p < 0.05.

Article Snippet: The lentiviral vectors including BC200 shRNA (LV-BC200-shRNA, KD), the full length of BC200 gene (LV-BC200, BC200), or negative control (CON053, NC) were constructed using the pGCSIL-004-hU6-CMV-EGF(GV115) vector by GenePharma Co (Shanghai, China).

Techniques: Knockdown, In Vivo, shRNA, Negative Control, Injection, Imaging, Fluorescence, Expressing

Gene expression change after BC200 knockdown. Gene expression profile analysis to screen a panel of differentially expressed genes after inhibiting the expression of BC200 in KYSE70 cells. The screening criteria for significant differential gene expression between the KD and NC groups included a fold change >1.5 and a p -value <0.05. (A) The cluster map of differentially expressed genes in all samples. Red indicates the signal value of upregulated genes, and green indicates the signal value of downregulated genes. (B) Bubble chart of selected upstream regulators predicted by IPA software. IPA software was used to predict the activation or inhibition of upstream regulators. According to the z score, −4.119, activated transcription factor 4 (ATF4) was predicted to be strongly inhibited. (C) The interaction between ATF4 and its directly related downstream molecules according to the IPA analysis. The orange line indicates consistent activation, the blue line indicates consistent suppression, and the yellow line indicates inconsistent expression. The gray line indicates that there is no prediction information related to the expression status in the data set.

Journal: Frontiers in Oncology

Article Title: LncRNA BC200 Promotes Esophageal Squamous Cell Cancer Migration and Invasion and Can Regulate ATF4 Expression

doi: 10.3389/fonc.2020.01392

Figure Lengend Snippet: Gene expression change after BC200 knockdown. Gene expression profile analysis to screen a panel of differentially expressed genes after inhibiting the expression of BC200 in KYSE70 cells. The screening criteria for significant differential gene expression between the KD and NC groups included a fold change >1.5 and a p -value <0.05. (A) The cluster map of differentially expressed genes in all samples. Red indicates the signal value of upregulated genes, and green indicates the signal value of downregulated genes. (B) Bubble chart of selected upstream regulators predicted by IPA software. IPA software was used to predict the activation or inhibition of upstream regulators. According to the z score, −4.119, activated transcription factor 4 (ATF4) was predicted to be strongly inhibited. (C) The interaction between ATF4 and its directly related downstream molecules according to the IPA analysis. The orange line indicates consistent activation, the blue line indicates consistent suppression, and the yellow line indicates inconsistent expression. The gray line indicates that there is no prediction information related to the expression status in the data set.

Article Snippet: The lentiviral vectors including BC200 shRNA (LV-BC200-shRNA, KD), the full length of BC200 gene (LV-BC200, BC200), or negative control (CON053, NC) were constructed using the pGCSIL-004-hU6-CMV-EGF(GV115) vector by GenePharma Co (Shanghai, China).

Techniques: Gene Expression, Knockdown, Expressing, Software, Activation Assay, Inhibition

The expression of ATF4/PSAT1/SNAIL2/GADD45A protein and mRNA in KYSE410 and KYSE70 cells transfected with BC200 shRNA (KD) or negative control (NC) was measured by Western blotting (A) and qRT-PCR assays (B–E) . Data showed that the mRNA and protein expression of all these genes was significantly reduced as a consequence of downregulating BC200 expression in ESCC KYSE70 and KYSE410 cells. The relative amount of BC200 was normalized to GAPDH. Data were analyzed using the 2 −ΔΔCT method. The relative expression of BC200 in KD was normalized to NC cells. Data are expressed as representative of three independent experiments. * p < 0.05. Error bars correspond to the mean ± SD.

Journal: Frontiers in Oncology

Article Title: LncRNA BC200 Promotes Esophageal Squamous Cell Cancer Migration and Invasion and Can Regulate ATF4 Expression

doi: 10.3389/fonc.2020.01392

Figure Lengend Snippet: The expression of ATF4/PSAT1/SNAIL2/GADD45A protein and mRNA in KYSE410 and KYSE70 cells transfected with BC200 shRNA (KD) or negative control (NC) was measured by Western blotting (A) and qRT-PCR assays (B–E) . Data showed that the mRNA and protein expression of all these genes was significantly reduced as a consequence of downregulating BC200 expression in ESCC KYSE70 and KYSE410 cells. The relative amount of BC200 was normalized to GAPDH. Data were analyzed using the 2 −ΔΔCT method. The relative expression of BC200 in KD was normalized to NC cells. Data are expressed as representative of three independent experiments. * p < 0.05. Error bars correspond to the mean ± SD.

Article Snippet: The lentiviral vectors including BC200 shRNA (LV-BC200-shRNA, KD), the full length of BC200 gene (LV-BC200, BC200), or negative control (CON053, NC) were constructed using the pGCSIL-004-hU6-CMV-EGF(GV115) vector by GenePharma Co (Shanghai, China).

Techniques: Expressing, Transfection, shRNA, Negative Control, Western Blot, Quantitative RT-PCR

Single‐cell transcriptomic analysis uncovers the characteristics of the aging corneal epithelium. (a) The schematic representation showing the single‐cell RNA sequencing (scRNA‐seq) analysis pipeline, which includes a comparative study of aging changes in the monkey corneal epithelium and across different organs (including hippocampus, lung, heart from monkeys, and bone and skin from humans). This representation also compares the aging process in the corneal epithelium across various species. (b) UMAP plot showing the seven cell types comprising primate corneal epithelium. LSCs, limbal stem cells; TACs, transit amplifying cells; MKI67+, PMCs, postmitotic cell; TDCs, terminally differentiated cells; Conj‐1, conjunctival epithelial cells‐1; Conj‐2, conjunctival epithelial cells‐2; MCs, melanocytes. (c) Heatmap showing the expression signature of the top 30 marker genes for each identified cell type. (d) Violin plots of gene set scores related to the SASP in young and aged groups. (e) Network visualization of core regulatory TFs in the 7 cell types in corneal epithelium between the old and young groups. (f) Volcano plots indicating that aging upregulates ZNF281 and FOXO3 in PMC of the corneal epithelium. (g) Dot plot showing the enriched GO term of ZNF281 target genes. (h) Dot plots showing the variation in ZNF281 expression during aging across different organ. Oligo, oligodendrocyte; Vip, VIP+ neuron; MuSC, muscle stem cell; CapEC, Capillary endothelial cell; SMC, smooth muscle cell. (i) Bubble plot showing the expression of ZNF281 target genes is uniquely upregulated in the stem cell in aging corneal epithelium. (j) Dot plot showing genes exhibiting oxidant capacity are specifically upregulated within stem cells in the aging corneal epithelium.

Journal: Aging Cell

Article Title: Comparative single‐cell transcriptomic analysis across tissues of aging primates reveals specific autologous activation of ZNF281 to mitigate oxidative stress in cornea

doi: 10.1111/acel.14319

Figure Lengend Snippet: Single‐cell transcriptomic analysis uncovers the characteristics of the aging corneal epithelium. (a) The schematic representation showing the single‐cell RNA sequencing (scRNA‐seq) analysis pipeline, which includes a comparative study of aging changes in the monkey corneal epithelium and across different organs (including hippocampus, lung, heart from monkeys, and bone and skin from humans). This representation also compares the aging process in the corneal epithelium across various species. (b) UMAP plot showing the seven cell types comprising primate corneal epithelium. LSCs, limbal stem cells; TACs, transit amplifying cells; MKI67+, PMCs, postmitotic cell; TDCs, terminally differentiated cells; Conj‐1, conjunctival epithelial cells‐1; Conj‐2, conjunctival epithelial cells‐2; MCs, melanocytes. (c) Heatmap showing the expression signature of the top 30 marker genes for each identified cell type. (d) Violin plots of gene set scores related to the SASP in young and aged groups. (e) Network visualization of core regulatory TFs in the 7 cell types in corneal epithelium between the old and young groups. (f) Volcano plots indicating that aging upregulates ZNF281 and FOXO3 in PMC of the corneal epithelium. (g) Dot plot showing the enriched GO term of ZNF281 target genes. (h) Dot plots showing the variation in ZNF281 expression during aging across different organ. Oligo, oligodendrocyte; Vip, VIP+ neuron; MuSC, muscle stem cell; CapEC, Capillary endothelial cell; SMC, smooth muscle cell. (i) Bubble plot showing the expression of ZNF281 target genes is uniquely upregulated in the stem cell in aging corneal epithelium. (j) Dot plot showing genes exhibiting oxidant capacity are specifically upregulated within stem cells in the aging corneal epithelium.

Article Snippet: Lentiviral vectors carrying shRNA against human FOXO3 and ZNF281, as well as FOXO3 and ZNF281 overexpression constructs, were generated and packaged by VectorBuilder (Guangzhou, China).

Techniques: RNA Sequencing, Expressing, Marker

ZNF281 and FOXO3 exhibit a consistent ability to sense and mitigate oxidant stress. (a) Bar plot showing the ZNF281 and FOXO3 mRNA levels are upregulated by H 2 O 2 treatment in hCECs. Data are presented as the mean ± SEM. n = 3 for CTRL and n = 4 for H 2 O 2 group. * p < 0.05. (b) Sample Western blot revealing upregulation of ZNF281 and FOXO3 by ROS accumulation. (c) Bar plot quantifying the Western blot reveals a significant increase in ZNF281 and FOXO3 protein levels as a result of ROS elevation. Data are presented as the mean ± SEM. n = 3 for each group. * p < 0.05. (d) Representative micrographs showing ROS levels as measured by DCFH‐DA fluorescence in control hCECs, FOXO3 ‐overexpressing (OE) hCECs, scramble control H 2 O 2 ‐treated hCECs, and FOXO3 ‐overexpressing H 2 O 2 ‐treated hCECs, Scale bars = 20 μm. (e) Bar plot of mean fluorescence intensity in (d). Data are presented as the mean ± SEM. n = 15 for each group. * p < 0.05. f, Representative micrographs showing ROS levels as measured by DCFH‐DA fluorescence in control hCECs, ZNF281 ‐overexpressing hCECs, scramble control H 2 O 2 ‐treated hCECs, and ZNF281 ‐overexpressing H 2 O 2 ‐treated hCECs, Scale bars = 20 μm. (g) Bar plot of mean fluorescence intensity in (f). Data are presented as the mean ± SEM. n = 15 for each group. * p < 0.05.

Journal: Aging Cell

Article Title: Comparative single‐cell transcriptomic analysis across tissues of aging primates reveals specific autologous activation of ZNF281 to mitigate oxidative stress in cornea

doi: 10.1111/acel.14319

Figure Lengend Snippet: ZNF281 and FOXO3 exhibit a consistent ability to sense and mitigate oxidant stress. (a) Bar plot showing the ZNF281 and FOXO3 mRNA levels are upregulated by H 2 O 2 treatment in hCECs. Data are presented as the mean ± SEM. n = 3 for CTRL and n = 4 for H 2 O 2 group. * p < 0.05. (b) Sample Western blot revealing upregulation of ZNF281 and FOXO3 by ROS accumulation. (c) Bar plot quantifying the Western blot reveals a significant increase in ZNF281 and FOXO3 protein levels as a result of ROS elevation. Data are presented as the mean ± SEM. n = 3 for each group. * p < 0.05. (d) Representative micrographs showing ROS levels as measured by DCFH‐DA fluorescence in control hCECs, FOXO3 ‐overexpressing (OE) hCECs, scramble control H 2 O 2 ‐treated hCECs, and FOXO3 ‐overexpressing H 2 O 2 ‐treated hCECs, Scale bars = 20 μm. (e) Bar plot of mean fluorescence intensity in (d). Data are presented as the mean ± SEM. n = 15 for each group. * p < 0.05. f, Representative micrographs showing ROS levels as measured by DCFH‐DA fluorescence in control hCECs, ZNF281 ‐overexpressing hCECs, scramble control H 2 O 2 ‐treated hCECs, and ZNF281 ‐overexpressing H 2 O 2 ‐treated hCECs, Scale bars = 20 μm. (g) Bar plot of mean fluorescence intensity in (f). Data are presented as the mean ± SEM. n = 15 for each group. * p < 0.05.

Article Snippet: Lentiviral vectors carrying shRNA against human FOXO3 and ZNF281, as well as FOXO3 and ZNF281 overexpression constructs, were generated and packaged by VectorBuilder (Guangzhou, China).

Techniques: Western Blot, Fluorescence, Control

ZNF281 and FOXO3 form a positive feedback loop to mitigate oxidative stress collaboratively. (a, b) Track plot showing the binding of ZNF281 to the FOXO3 promoter region (a) and vice versa (b). (c) Sample Western blot showing significant reductions in ZNF281 and FOXO3 protein expression levels upon FOXO3 or ZNF281 knockdown, respectively. (d, e) Bar plots of Western blotting results showing that ZNF281 protein levels were significantly reduced by FOXO3 knockdown (d) and FOXO3 protein levels by ZNF281 knockdown (e). (d) Data are presented as the mean ± SEM. n = 3 for each group. * p < 0.05. (e) Data are presented as the mean ± SEM. n = 4 for each group. * p < 0.05. (f, g) Sample Western blot (f) and densitometric quantitation (g) revealing that FOXO3 overexpression significantly enhanced ZNF281 protein level. Data are presented as the mean ± SEM. n = 3 for each group. * p < 0.05. (h) Venn plot showing that the majority of whole‐genome FOXO3 binding sites are co‐occupied by ZNF281. (i) Heatmaps depicting the CUT&Tag intensities of ZNF281 and FOXO3 based on FOXO3‐specific peaks, ZNF281‐specific peaks, and overlapping peaks, respectively. (j) Bubble plot of enriched GO terms for genes nearest to the overlapping peaks of ZNF281 and FOXO3. (k–m) Track plots showing the binding of ZNF281 and FOXO3 to the promoter regions of antioxidant genes (k, l) and genes involved in the OXPHOS (m).

Journal: Aging Cell

Article Title: Comparative single‐cell transcriptomic analysis across tissues of aging primates reveals specific autologous activation of ZNF281 to mitigate oxidative stress in cornea

doi: 10.1111/acel.14319

Figure Lengend Snippet: ZNF281 and FOXO3 form a positive feedback loop to mitigate oxidative stress collaboratively. (a, b) Track plot showing the binding of ZNF281 to the FOXO3 promoter region (a) and vice versa (b). (c) Sample Western blot showing significant reductions in ZNF281 and FOXO3 protein expression levels upon FOXO3 or ZNF281 knockdown, respectively. (d, e) Bar plots of Western blotting results showing that ZNF281 protein levels were significantly reduced by FOXO3 knockdown (d) and FOXO3 protein levels by ZNF281 knockdown (e). (d) Data are presented as the mean ± SEM. n = 3 for each group. * p < 0.05. (e) Data are presented as the mean ± SEM. n = 4 for each group. * p < 0.05. (f, g) Sample Western blot (f) and densitometric quantitation (g) revealing that FOXO3 overexpression significantly enhanced ZNF281 protein level. Data are presented as the mean ± SEM. n = 3 for each group. * p < 0.05. (h) Venn plot showing that the majority of whole‐genome FOXO3 binding sites are co‐occupied by ZNF281. (i) Heatmaps depicting the CUT&Tag intensities of ZNF281 and FOXO3 based on FOXO3‐specific peaks, ZNF281‐specific peaks, and overlapping peaks, respectively. (j) Bubble plot of enriched GO terms for genes nearest to the overlapping peaks of ZNF281 and FOXO3. (k–m) Track plots showing the binding of ZNF281 and FOXO3 to the promoter regions of antioxidant genes (k, l) and genes involved in the OXPHOS (m).

Article Snippet: Lentiviral vectors carrying shRNA against human FOXO3 and ZNF281, as well as FOXO3 and ZNF281 overexpression constructs, were generated and packaged by VectorBuilder (Guangzhou, China).

Techniques: Binding Assay, Western Blot, Expressing, Knockdown, Quantitation Assay, Over Expression

ZNF281 and FOXO3 both regulate oxidative phosphorylation in the corneal epithelium. (a–d) Enrichment plots showing upregulation of the Glycolysis/Gluconeogenesis gene sets by ZNF281 knockdown (a), upregulation of the “Oxidative Phosphorylation (OXPHOS)”gene set by ZNF281 knockdown (b), upregulation of the“Glycolysis/Gluconeogenesis”gene set by FOXO3 knockdown (c), and upregulation of the OXPHOS gene set by FOXO3 knockdown (d). (e) Seahorse XF analysis of extracellular acidification rate (ECAR) in hCECs following ZNF281 and FOXO3 knockdown. (f, g) Bar plots showing the significantly upregulation of glycolysis rate (f) and glycolytic capacity (g) after ZNF281 and FOXO3 knockdown. (f) Data are presented as the mean ± SEM. n = 15 for each group. **** p < 0.0001. (g) Data are presented as the mean ± SEM. n = 15 for each group. **** p < 0.0001. (h) Seahorse XF analysis of oxygen consumption rate (OCR) in hCECs following ZNF281 and FOXO3 knockdown. (i, j) Bar plots showing the significantly upregulation of basal OCR (i) and max OCR (j) following ZNF281 and FOXO3 knockdown. (i) Data are presented as the mean ± SEM. n = 15 for each group. **** p < 0.0001. (j) Data are presented as the mean ± SEM. n = 15 for each group. **** p < 0.0001. (k) Heatmap presents changes in metabolism‐related gene expression levels after ZNF281 knockdown. (l–n) Track plots showing the binding of ZNF281 and FOXO3 to the promoter regions of TFAM (l), TFB1M (m), and TFB2M (n).

Journal: Aging Cell

Article Title: Comparative single‐cell transcriptomic analysis across tissues of aging primates reveals specific autologous activation of ZNF281 to mitigate oxidative stress in cornea

doi: 10.1111/acel.14319

Figure Lengend Snippet: ZNF281 and FOXO3 both regulate oxidative phosphorylation in the corneal epithelium. (a–d) Enrichment plots showing upregulation of the Glycolysis/Gluconeogenesis gene sets by ZNF281 knockdown (a), upregulation of the “Oxidative Phosphorylation (OXPHOS)”gene set by ZNF281 knockdown (b), upregulation of the“Glycolysis/Gluconeogenesis”gene set by FOXO3 knockdown (c), and upregulation of the OXPHOS gene set by FOXO3 knockdown (d). (e) Seahorse XF analysis of extracellular acidification rate (ECAR) in hCECs following ZNF281 and FOXO3 knockdown. (f, g) Bar plots showing the significantly upregulation of glycolysis rate (f) and glycolytic capacity (g) after ZNF281 and FOXO3 knockdown. (f) Data are presented as the mean ± SEM. n = 15 for each group. **** p < 0.0001. (g) Data are presented as the mean ± SEM. n = 15 for each group. **** p < 0.0001. (h) Seahorse XF analysis of oxygen consumption rate (OCR) in hCECs following ZNF281 and FOXO3 knockdown. (i, j) Bar plots showing the significantly upregulation of basal OCR (i) and max OCR (j) following ZNF281 and FOXO3 knockdown. (i) Data are presented as the mean ± SEM. n = 15 for each group. **** p < 0.0001. (j) Data are presented as the mean ± SEM. n = 15 for each group. **** p < 0.0001. (k) Heatmap presents changes in metabolism‐related gene expression levels after ZNF281 knockdown. (l–n) Track plots showing the binding of ZNF281 and FOXO3 to the promoter regions of TFAM (l), TFB1M (m), and TFB2M (n).

Article Snippet: Lentiviral vectors carrying shRNA against human FOXO3 and ZNF281, as well as FOXO3 and ZNF281 overexpression constructs, were generated and packaged by VectorBuilder (Guangzhou, China).

Techniques: Phospho-proteomics, Knockdown, Gene Expression, Binding Assay

The diagram illustrates the functions of ZNF281 and FOXO3 in corneal epithelial cells during aging. As cells age, there is an increase in the production of reactive oxygen species (ROS), leading to oxidative stress. ZNF281 and FOXO3 serve as sensors for ROS and mutually enhance their expression levels. A potential mechanism for ROS‐mediated upregulation of ZNF281 and FOXO3 involves the induction of FOXO3 phosphorylation by ROS. This phosphorylation prompts FOXO3's translocation from the cytoplasm to the nucleus. Once inside the nucleus, FOXO3 and ZNF281 form a complex with other co‐regulators to upregulate their own expression. The elevated expression of these transcription factors subsequently upregulates antioxidant genes expression, such as SOD1 and SOD2, while downregulating genes related to OXPHOS in mitochondria, and those that govern mitochondrial biogenesis. This coordinated response effectively reduces cellular ROS levels.

Journal: Aging Cell

Article Title: Comparative single‐cell transcriptomic analysis across tissues of aging primates reveals specific autologous activation of ZNF281 to mitigate oxidative stress in cornea

doi: 10.1111/acel.14319

Figure Lengend Snippet: The diagram illustrates the functions of ZNF281 and FOXO3 in corneal epithelial cells during aging. As cells age, there is an increase in the production of reactive oxygen species (ROS), leading to oxidative stress. ZNF281 and FOXO3 serve as sensors for ROS and mutually enhance their expression levels. A potential mechanism for ROS‐mediated upregulation of ZNF281 and FOXO3 involves the induction of FOXO3 phosphorylation by ROS. This phosphorylation prompts FOXO3's translocation from the cytoplasm to the nucleus. Once inside the nucleus, FOXO3 and ZNF281 form a complex with other co‐regulators to upregulate their own expression. The elevated expression of these transcription factors subsequently upregulates antioxidant genes expression, such as SOD1 and SOD2, while downregulating genes related to OXPHOS in mitochondria, and those that govern mitochondrial biogenesis. This coordinated response effectively reduces cellular ROS levels.

Article Snippet: Lentiviral vectors carrying shRNA against human FOXO3 and ZNF281, as well as FOXO3 and ZNF281 overexpression constructs, were generated and packaged by VectorBuilder (Guangzhou, China).

Techniques: Expressing, Phospho-proteomics, Translocation Assay

GPR171 partially mediates CCL2 production via the ERK1/2 pathway. (A–C) GPR171 expression was verified in GPR171‐knockdown RBL‐2H3 cells by RT‐qPCR and western blotting. (D) Percentage of β‐hexosaminidase released into the supernatants from control shRNA‐treated and GPR171 shRNA‐treated RBL‐2H3 cells in response to H. pylori infection. (E) The mRNA levels of the 6 cytokines in control shRNA‐treated and GPR171 shRNA‐treated cells stimulated with H. pylori . (F) CCL2 levels in the supernatants of shRNA‐treated and GPR171 shRNA‐treated RBL‐2H3 cells co‐cultured with H. pylori . (G) GO enrichment of DEGs based on RNA‐seq data. (H) Immunoblot analysis and quantification of ERK1/2 phosphorylation in RBL‐2H3 cells that were or were not treated with H. pylori . p‐ERK expression was normalized to total ERK. (I) RT‐qPCR analysis of CCL2 mRNA expression in mast cells co‐cultured with or without H. pylori . (J) CCL2 levels in supernatants were quantified by ELISA. Cells were pretreated with 5 μM U0126 as indicated (H–J). (K) Immunoblot analysis and quantification of p‐ERK in control shRNA‐treated and GPR171 shRNA‐treated cells following H. pylori stimulation. (L, M) Western blot analysis of ERK1/2 phosphorylation expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . (N, O) RT‐qPCR and ELISA analysis of CCL2 expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . MS21570: A blocker of GPR171. Statistical significance was determined by Student's unpaired t ‐test (A, C, D, E, F, K) and one‐way ANOVA (H, I, J, M, N, O), * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Helicobacter

Article Title: HIF ‐1α‐Induced GPR171 Expression Mediates CCL2 Secretion by Mast Cells to Promote Gastric Inflammation During Helicobacter pylori Infection

doi: 10.1111/hel.70042

Figure Lengend Snippet: GPR171 partially mediates CCL2 production via the ERK1/2 pathway. (A–C) GPR171 expression was verified in GPR171‐knockdown RBL‐2H3 cells by RT‐qPCR and western blotting. (D) Percentage of β‐hexosaminidase released into the supernatants from control shRNA‐treated and GPR171 shRNA‐treated RBL‐2H3 cells in response to H. pylori infection. (E) The mRNA levels of the 6 cytokines in control shRNA‐treated and GPR171 shRNA‐treated cells stimulated with H. pylori . (F) CCL2 levels in the supernatants of shRNA‐treated and GPR171 shRNA‐treated RBL‐2H3 cells co‐cultured with H. pylori . (G) GO enrichment of DEGs based on RNA‐seq data. (H) Immunoblot analysis and quantification of ERK1/2 phosphorylation in RBL‐2H3 cells that were or were not treated with H. pylori . p‐ERK expression was normalized to total ERK. (I) RT‐qPCR analysis of CCL2 mRNA expression in mast cells co‐cultured with or without H. pylori . (J) CCL2 levels in supernatants were quantified by ELISA. Cells were pretreated with 5 μM U0126 as indicated (H–J). (K) Immunoblot analysis and quantification of p‐ERK in control shRNA‐treated and GPR171 shRNA‐treated cells following H. pylori stimulation. (L, M) Western blot analysis of ERK1/2 phosphorylation expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . (N, O) RT‐qPCR and ELISA analysis of CCL2 expression in RBL‐2H3 cells treated with different concentrations of MS21570 (0, 5, 10, and 20 μM) and co‐cultured with or without H. pylori . MS21570: A blocker of GPR171. Statistical significance was determined by Student's unpaired t ‐test (A, C, D, E, F, K) and one‐way ANOVA (H, I, J, M, N, O), * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Lentiviral vectors carrying GFP and either shRNA targeting GPR171 mRNA or a non‐targeting control shRNA were customized (GenePharma, China).

Techniques: Expressing, Knockdown, Quantitative RT-PCR, Western Blot, Control, shRNA, Infection, Cell Culture, RNA Sequencing, Phospho-proteomics, Enzyme-linked Immunosorbent Assay